97
|
ATCC
c guilliermondii atcc 6260 reference strain whole genome C Guilliermondii Atcc 6260 Reference Strain Whole Genome, supplied by ATCC, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/c guilliermondii atcc 6260 reference strain whole genome/product/ATCC Average 97 stars, based on 1 article reviews
c guilliermondii atcc 6260 reference strain whole genome - by Bioz Stars,
2026-04
97/100 stars
|
Buy from Supplier |
95
|
Chem Impex International
trifluoro acetic acid tfa Trifluoro Acetic Acid Tfa, supplied by Chem Impex International, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/trifluoro acetic acid tfa/product/Chem Impex International Average 95 stars, based on 1 article reviews
trifluoro acetic acid tfa - by Bioz Stars,
2026-04
95/100 stars
|
Buy from Supplier |
97
|
Bio-Rad
precision plus protein dual color standards biorad Precision Plus Protein Dual Color Standards Biorad, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/precision plus protein dual color standards biorad/product/Bio-Rad Average 97 stars, based on 1 article reviews
precision plus protein dual color standards biorad - by Bioz Stars,
2026-04
97/100 stars
|
Buy from Supplier |
90
|
GenScript corporation
genes encoding α-ketoisocaproate dioxygenase from rattus norvegicus (rnkicd, ncbi reference sequence: np_058929.1) Genes Encoding α Ketoisocaproate Dioxygenase From Rattus Norvegicus (Rnkicd, Ncbi Reference Sequence: Np 058929.1), supplied by GenScript corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/genes encoding α-ketoisocaproate dioxygenase from rattus norvegicus (rnkicd, ncbi reference sequence: np_058929.1)/product/GenScript corporation Average 90 stars, based on 1 article reviews
genes encoding α-ketoisocaproate dioxygenase from rattus norvegicus (rnkicd, ncbi reference sequence: np_058929.1) - by Bioz Stars,
2026-04
90/100 stars
|
Buy from Supplier |
90
|
Biotechnology Information
reference sequence (refseq) database Reference Sequence (Refseq) Database, supplied by Biotechnology Information, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/reference sequence (refseq) database/product/Biotechnology Information Average 90 stars, based on 1 article reviews
reference sequence (refseq) database - by Bioz Stars,
2026-04
90/100 stars
|
Buy from Supplier |
90
|
Clinical and Laboratory Standards Institute
16s rrna gene sequence analysis 16s Rrna Gene Sequence Analysis, supplied by Clinical and Laboratory Standards Institute, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/16s rrna gene sequence analysis/product/Clinical and Laboratory Standards Institute Average 90 stars, based on 1 article reviews
16s rrna gene sequence analysis - by Bioz Stars,
2026-04
90/100 stars
|
Buy from Supplier |
90
|
Clinical and Laboratory Standards Institute
rmlst scheme Rmlst Scheme, supplied by Clinical and Laboratory Standards Institute, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/rmlst scheme/product/Clinical and Laboratory Standards Institute Average 90 stars, based on 1 article reviews
rmlst scheme - by Bioz Stars,
2026-04
90/100 stars
|
Buy from Supplier |
90
|
Jackson Laboratory
primer name nucleotide sequence (5′ → 3′) product size reference gfap-cre oimr1084 oimr1085 gcggtctggcagtaaaaactatc gtgaaacagcattgctgtcactt Primer Name Nucleotide Sequence (5′ → 3′) Product Size Reference Gfap Cre Oimr1084 Oimr1085 Gcggtctggcagtaaaaactatc Gtgaaacagcattgctgtcactt, supplied by Jackson Laboratory, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/primer name nucleotide sequence (5′ → 3′) product size reference gfap-cre oimr1084 oimr1085 gcggtctggcagtaaaaactatc gtgaaacagcattgctgtcactt/product/Jackson Laboratory Average 90 stars, based on 1 article reviews
primer name nucleotide sequence (5′ → 3′) product size reference gfap-cre oimr1084 oimr1085 gcggtctggcagtaaaaactatc gtgaaacagcattgctgtcactt - by Bioz Stars,
2026-04
90/100 stars
|
Buy from Supplier |
90
|
Supranational Reference Laboratories
long-read pacbio sequencing Long Read Pacbio Sequencing, supplied by Supranational Reference Laboratories, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/long-read pacbio sequencing/product/Supranational Reference Laboratories Average 90 stars, based on 1 article reviews
long-read pacbio sequencing - by Bioz Stars,
2026-04
90/100 stars
|
Buy from Supplier |
90
|
Gallus BioPharmaceuticals
human reference sequences Human Reference Sequences, supplied by Gallus BioPharmaceuticals, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/human reference sequences/product/Gallus BioPharmaceuticals Average 90 stars, based on 1 article reviews
human reference sequences - by Bioz Stars,
2026-04
90/100 stars
|
Buy from Supplier |
90
|
Biotechnology Information
ncbi reference sequence database Ncbi Reference Sequence Database, supplied by Biotechnology Information, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/ncbi reference sequence database/product/Biotechnology Information Average 90 stars, based on 1 article reviews
ncbi reference sequence database - by Bioz Stars,
2026-04
90/100 stars
|
Buy from Supplier |
90
|
Kazusa Genome Technologies
custom reference sequence Custom Reference Sequence, supplied by Kazusa Genome Technologies, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/custom reference sequence/product/Kazusa Genome Technologies Average 90 stars, based on 1 article reviews
custom reference sequence - by Bioz Stars,
2026-04
90/100 stars
|
Buy from Supplier |